Job entitled as Example data, referenced id: 6ffc5bee490e0e2dee3353a1665a7552

Job Status: Complete

Submitted by:
    Yongbing Zhao (yongbing.zhao@nih.gov)
 
Date Submitted:
    2018-03-19 20:32:00
 
Screening Parameters:
     PAM type: xCas9 3.7 (PAM: NG, GAA, GAT)
     Target genome: Mouse (mm10)
     sgRNA Size: 20bp
     Sequence number: 3
 
 
Table 1: Guide sgRNAs for the sequence [example1]
Guide # sgRNA Sequence(+PAM) GC content Strand Position on
sequence
Off-target
Number
Off-target Number
at TSS|Exon|Intergenic
Top3 Off-target
Sites Scores
sgRNA Score
(Based on Off-target)
PAM Score Cas9 Loading
Score
Forward oligo primer Reverse oligo primer
#1 GGGCAATGCTGCGTCGTCGTAGT 65% + 95 66 3|4|59 0.51 | 0.47 | 0.45 95 ★★☆☆ 34.5 caccGGGCAATGCTGCGTCGTCGT aaacACGACGACGCAGCATTGCCC
#2 CCAAAAAACTACGACGACGCAGC 50% - -4 55 3|3|49 0.64 | 0.64 | 0.44 94 ★★☆☆ 49 caccgCCAAAAAACTACGACGACGC aaacGCGTCGTCGTAGTTTTTTGGc
#3 GCTGCGTCGTCGTAGTTTTTTGG 50% + 102 49 2|2|45 0.74 | 0.72 | 0.49 92 ★★☆☆ 13.5 caccGCTGCGTCGTCGTAGTTTTT aaacAAAAACTACGACGACGCAGC
#4 AGGGGGCAATGCTGCGTCGTCGT 65% + 92 128 6|7|115 0.91 | 0.71 | 0.51 90 ★★★★ 34.5 caccgAGGGGGCAATGCTGCGTCGT aaacACGACGCAGCATTGCCCCCTc
#5 AAACTACGACGACGCAGCATTGC 50% - -9 68 2|10|56 0.9 | 0.7 | 0.67 89 ★★☆☆ 45 caccgAAACTACGACGACGCAGCAT aaacATGCTGCGTCGTCGTAGTTTc
#6 CCCCCAAAAAACTACGACGACGC 50% - -1 204 3|6|195 1.38 | 1.22 | 0.81 89 ★★☆☆ 57 caccgCCCCCAAAAAACTACGACGA aaacTCGTCGTAGTTTTTTGGGGGc
#7 AGTCCAGCACTCGCTCGCGCCGG 70% - -82 100 5|25|70 1.57 | 0.84 | 0.66 87 ★★★☆ 54 caccgAGTCCAGCACTCGCTCGCGC aaacGCGCGAGCGAGTGCTGGACTc
#8 GTCCCTGCAGCTCCGACGAGCGA 70% - -104 212 16|20|176 3.26 | 0.84 | 0.64 84 ★★★★ 55 caccGTCCCTGCAGCTCCGACGAG aaacCTCGTCGGAGCTGCAGGGAC
#9 AACAGTCCAGCACTCGCTCGCGC 60% - -79 229 2|19|208 0.86 | 0.82 | 0.71 84 ★★☆☆ 43 caccgAACAGTCCAGCACTCGCTCG aaacCGAGCGAGTGCTGGACTGTTc
#10 GACCGGCGCGAGCGAGTGCTGGA 75% + 22 69 8|30|31 1.68 | 1.29 | 1.29 83 ★☆☆☆ 26.5 caccGACCGGCGCGAGCGAGTGCT aaacAGCACTCGCTCGCGCCGGTC
#11 GTCCAGCACTCGCTCGCGCCGGT 75% - -83 107 10|31|66 2.6 | 2.54 | 0.82 83 ★★★☆ 42 caccGTCCAGCACTCGCTCGCGCC aaacGGCGCGAGCGAGTGCTGGAC
#12 CGGTCCCTGCAGCTCCGACGAGC 75% - -102 128 6|32|90 1.34 | 1.27 | 1.11 82 ★★☆☆ 52 caccgCGGTCCCTGCAGCTCCGACG aaacCGTCGGAGCTGCAGGGACCGc
#13 GCGTCGTCGTAGTTTTTTGGGGG 50% + 105 59 3|2|54 1.38 | 1.38 | 1.34 81 ★★★☆ 41.5 caccGCGTCGTCGTAGTTTTTTGG aaacCCAAAAAACTACGACGACGC
#14 GGACCGGCGCGAGCGAGTGCTGG 80% + 21 130 16|57|57 1.46 | 1.25 | 0.91 80 ★★☆☆ 46 caccGGACCGGCGCGAGCGAGTGC aaacGCACTCGCTCGCGCCGGTCC
#15 TCGCTCGCGCCGGTCCCTGCAGC 80% - -92 117 19|32|66 1.63 | 1.59 | 1.31 80 ★★☆☆ 42 caccgTCGCTCGCGCCGGTCCCTGC aaacGCAGGGACCGGCGCGAGCGAc
#16 TGCGTCGTCGTAGTTTTTTGGGG 45% + 104 84 3|3|78 1.46 | 1.29 | 0.91 78 ★★★☆ 28.5 caccgTGCGTCGTCGTAGTTTTTTG aaacCAAAAAACTACGACGACGCAc
#17 CTGCGTCGTCGTAGTTTTTTGGG 45% + 103 69 2|2|65 1.56 | 1.35 | 1.31 78 ★★★☆ 13.5 caccgCTGCGTCGTCGTAGTTTTTT aaacAAAAAACTACGACGACGCAGc
#18 CTAAGGGGGCAATGCTGCGTCGT 60% + 89 143 3|11|129 2.17 | 1.19 | 1.04 77 ★★★★ 47 caccgCTAAGGGGGCAATGCTGCGT aaacACGCAGCATTGCCCCCTTAGc
#19 AGCCACATGGGTCCCCTCGGAGC 70% - -48 252 8|24|220 1.36 | 0.94 | 0.93 76 ★★☆☆ 49.5 caccgAGCCACATGGGTCCCCTCGG aaacCCGAGGGGACCCATGTGGCTc
#20 GGCGCGAGCGAGTGCTGGACTGT 75% + 26 129 15|25|89 2.33 | 1.36 | 1.27 75 ★★★☆ 51 caccGGCGCGAGCGAGTGCTGGAC aaacGTCCAGCACTCGCTCGCGCC
#21 CGACGCAGCATTGCCCCCTTAGC 65% - -18 93 2|10|81 2.42 | 1.38 | 1.31 75 ★★☆☆ 30 caccgCGACGCAGCATTGCCCCCTT aaacAAGGGGGCAATGCTGCGTCGc
#22 TGCAGGGACCGGCGCGAGCGAGT 80% + 16 161 27|38|96 2.46 | 1.5 | 1.25 72 ★★☆☆ 49 caccgTGCAGGGACCGGCGCGAGCG aaacCGCTCGCGCCGGTCCCTGCAc
#23 GTCGCTCGTCGGAGCTGCAGGGA 70% + 1 95 12|15|68 1.68 | 1.44 | 1.31 72 ★☆☆☆ 60 caccGTCGCTCGTCGGAGCTGCAG aaacCTGCAGCTCCGACGAGCGAC
#24 GAGCTGCAGGGACCGGCGCGAGC 80% + 12 306 36|82|188 1.69 | 1.43 | 1.35 71 ★★☆☆ 50 caccGAGCTGCAGGGACCGGCGCG aaacCGCGCCGGTCCCTGCAGCTC
#25 GCTGCAGGGACCGGCGCGAGCGA 80% + 14 250 27|58|165 2.33 | 2.33 | 1.65 69 ★★★★ 55 caccGCTGCAGGGACCGGCGCGAG aaacCTCGCGCCGGTCCCTGCAGC
#26 CGAGCGAGTGCTGGACTGTTTGT 60% + 30 183 5|6|172 2.39 | 1.31 | 1.29 68 ★★★☆ 20.5 caccgCGAGCGAGTGCTGGACTGTT aaacAACAGTCCAGCACTCGCTCGc
#27 CAAACAGTCCAGCACTCGCTCGC 55% - -77 372 8|22|342 3.86 | 1.39 | 1.31 66 ★★☆☆ 35 caccgCAAACAGTCCAGCACTCGCT aaacAGCGAGTGCTGGACTGTTTGc
#28 GGCTCCGAGGGGACCCATGTGGC 70% + 57 251 13|25|213 1.67 | 1.67 | 1.07 66 ★★★☆ 34 caccGGCTCCGAGGGGACCCATGT aaacACATGGGTCCCCTCGGAGCC
#29 CGGAGCTGCAGGGACCGGCGCGA 80% + 10 324 31|92|201 5.54 | 2.36 | 1.72 64 ★★★★ 54 caccgCGGAGCTGCAGGGACCGGCG aaacCGCCGGTCCCTGCAGCTCCGc
#30 CAGGGACCGGCGCGAGCGAGTGC 80% + 18 398 35|40|323 1.41 | 1.09 | 0.87 62 ★★☆☆ 55 caccgCAGGGACCGGCGCGAGCGAG aaacCTCGCTCGCGCCGGTCCCTGc
#31 CTGTTTGTGCAGGGCTCCGAGGG 60% + 45 476 10|29|437 1.34 | 1.07 | 1.04 62 ★★★☆ 58 caccgCTGTTTGTGCAGGGCTCCGA aaacTCGGAGCCCTGCACAAACAGc
#32 ACTGTTTGTGCAGGGCTCCGAGG 60% + 44 416 12|29|375 4.56 | 2.52 | 1.42 56 ★★☆☆ 42.5 caccgACTGTTTGTGCAGGGCTCCG aaacCGGAGCCCTGCACAAACAGTc
#33 AGCGAGTGCTGGACTGTTTGTGC 55% + 32 333 13|13|307 2.39 | 1.63 | 1.48 56 ★★☆☆ 28.5 caccgAGCGAGTGCTGGACTGTTTG aaacCAAACAGTCCAGCACTCGCTc
#34 GTCGGAGCTGCAGGGACCGGCGC 75% + 8 409 22|81|306 4.75 | 2.37 | 2.37 55 ★★☆☆ 58 caccGTCGGAGCTGCAGGGACCGG aaacCCGGTCCCTGCAGCTCCGAC
#35 GGGCTCCGAGGGGACCCATGTGG 75% + 56 348 21|35|292 2.27 | 1.73 | 1.51 55 ★★☆☆ 42 caccGGGCTCCGAGGGGACCCATG aaacCATGGGTCCCCTCGGAGCCC
#36 GTTTGTGCAGGGCTCCGAGGGGA 65% + 47 476 17|47|412 6.38 | 3.29 | 2.5 55 ★☆☆☆ 59 caccGTTTGTGCAGGGCTCCGAGG aaacCCTCGGAGCCCTGCACAAAC
#37 TGTTTGTGCAGGGCTCCGAGGGG 60% + 46 534 12|37|485 4.21 | 2.52 | 2.36 54 ★★★☆ 55 caccgTGTTTGTGCAGGGCTCCGAG aaacCTCGGAGCCCTGCACAAACAc
#38 CGCGCCGGTCCCTGCAGCTCCGA 80% - -97 233 28|69|136 5.45 | 1.67 | 1.67 53 ★★★★ 41 caccgCGCGCCGGTCCCTGCAGCTC aaacGAGCTGCAGGGACCGGCGCGc
#39 TCGTCGGAGCTGCAGGGACCGGC 70% + 6 229 7|34|188 2.6 | 2.42 | 2.28 53 ★★★☆ 44 caccgTCGTCGGAGCTGCAGGGACC aaacGGTCCCTGCAGCTCCGACGAc
#40 CACTCGCTCGCGCCGGTCCCTGC 80% - -89 296 21|43|232 1.39 | 1.27 | 1.09 52 ★★☆☆ 34.5 caccgCACTCGCTCGCGCCGGTCCC aaacGGGACCGGCGCGAGCGAGTGc
#41 GCCGGTCCCTGCAGCTCCGACGA 75% - -100 362 15|46|301 6.38 | 2.39 | 2.39 52 ★★★★ 58 caccGCCGGTCCCTGCAGCTCCGA aaacTCGGAGCTGCAGGGACCGGC
#42 TGAGCCACATGGGTCCCCTCGGA 65% - -46 492 20|38|434 5.83 | 4.56 | 4.32 50 ★☆☆☆ 37 caccgTGAGCCACATGGGTCCCCTC aaacGAGGGGACCCATGTGGCTCAc
#43 CGAGGGGACCCATGTGGCTCAGG 70% + 62 323 15|23|285 1.63 | 1.54 | 1.48 50 ★★☆☆ 41 caccgCGAGGGGACCCATGTGGCTC aaacGAGCCACATGGGTCCCCTCGc
#44 CCTCGGAGCCCTGCACAAACAGT 65% - -62 397 8|38|351 6.38 | 5.89 | 2.36 49 ★★☆☆ 44 caccgCCTCGGAGCCCTGCACAAAC aaacGTTTGTGCAGGGCTCCGAGGc
#45 CTCGTCGGAGCTGCAGGGACCGG 70% + 5 385 10|35|340 2.28 | 1.67 | 1.62 47 ★★★☆ 51 caccgCTCGTCGGAGCTGCAGGGAC aaacGTCCCTGCAGCTCCGACGAGc
#46 CTGAGCCACATGGGTCCCCTCGG 65% - -45 626 25|49|552 1.65 | 1.56 | 1.44 47 ★★★☆ 36 caccgCTGAGCCACATGGGTCCCCT aaacAGGGGACCCATGTGGCTCAGc
#47 GAGCCCTGCACAAACAGTCCAGC 60% - -67 560 10|26|524 2.51 | 2.46 | 2.28 46 ★★☆☆ 39 caccGAGCCCTGCACAAACAGTCC aaacGGACTGTTTGTGCAGGGCTC
#48 TGCACAAACAGTCCAGCACTCGC 50% - -73 544 18|21|505 1.52 | 1.52 | 1.52 46 ★★☆☆ 33 caccgTGCACAAACAGTCCAGCACT aaacAGTGCTGGACTGTTTGTGCAc
#49 CATGGGTCCCCTCGGAGCCCTGC 75% - -53 437 21|46|370 38.7 | 4.33 | 3.29 46 ★★☆☆ 47 caccgCATGGGTCCCCTCGGAGCCC aaacGGGCTCCGAGGGGACCCATGc
#50 ATGTGGCTCAGGGTGGCTAAGGG 55% + 73 712 18|26|668 3.91 | 2.39 | 2.27 44 ★★★☆ 48 caccgATGTGGCTCAGGGTGGCTAA aaacTTAGCCACCCTGAGCCACATc
#51 CATTGCCCCCTTAGCCACCCTGA 65% - -26 503 8|20|475 17.2 | 3 | 2.36 43 ★★★☆ 42 caccgCATTGCCCCCTTAGCCACCC aaacGGGTGGCTAAGGGGGCAATGc
#52 GGTGGCTAAGGGGGCAATGCTGC 65% + 84 848 14|31|803 6.38 | 1.52 | 1.49 43 ★★☆☆ 41 caccGGTGGCTAAGGGGGCAATGC aaacGCATTGCCCCCTTAGCCACC
#53 GAGGGGACCCATGTGGCTCAGGG 65% + 63 563 14|45|504 7.08 | 5.72 | 3.26 39 ★★★☆ 43 caccGAGGGGACCCATGTGGCTCA aaacTGAGCCACATGGGTCCCCTC
#54 GTGGCTCAGGGTGGCTAAGGGGG 65% + 75 729 23|59|647 5.83 | 5.38 | 5.14 39 ★★★☆ 54 caccGTGGCTCAGGGTGGCTAAGG aaacCCTTAGCCACCCTGAGCCAC
#55 TGGCTCAGGGTGGCTAAGGGGGC 65% + 76 791 28|49|714 14.9 | 3.86 | 3.26 39 ★★★☆ 56 caccgTGGCTCAGGGTGGCTAAGGG aaacCCCTTAGCCACCCTGAGCCAc
#56 TTGCCCCCTTAGCCACCCTGAGC 65% - -28 539 9|38|492 6.01 | 3.89 | 3.59 38 ★★☆☆ 45 caccgTTGCCCCCTTAGCCACCCTG aaacCAGGGTGGCTAAGGGGGCAAc
#57 GAGTGCTGGACTGTTTGTGCAGG 55% + 35 705 16|25|664 3.07 | 2.28 | 1.56 37 ★★☆☆ 46 caccGAGTGCTGGACTGTTTGTGC aaacGCACAAACAGTCCAGCACTC
#58 TGTGGCTCAGGGTGGCTAAGGGG 60% + 74 942 28|43|871 6.43 | 6.24 | 5.21 36 ★★★☆ 44.5 caccgTGTGGCTCAGGGTGGCTAAG aaacCTTAGCCACCCTGAGCCACAc
#59 CAGGGCTCCGAGGGGACCCATGT 75% + 54 611 22|79|510 6.94 | 4.25 | 3.86 36 ★★★☆ 51 caccgCAGGGCTCCGAGGGGACCCA aaacTGGGTCCCCTCGGAGCCCTGc
#60 GGACTGTTTGTGCAGGGCTCCGA 60% + 42 660 11|28|621 6.69 | 4.27 | 4.03 35 ★★★★ 41 caccGGACTGTTTGTGCAGGGCTC aaacGAGCCCTGCACAAACAGTCC
#61 AGTGCTGGACTGTTTGTGCAGGG 50% + 36 689 23|34|632 60.5 | 5.21 | 1.72 33 ★★★☆ 41.5 caccgAGTGCTGGACTGTTTGTGCA aaacTGCACAAACAGTCCAGCACTc
#62 TGGCTAAGGGGGCAATGCTGCGT 60% + 86 1647 8|37|1602 2.34 | 2.34 | 2.03 30 ★★★★ 49 caccgTGGCTAAGGGGGCAATGCTG aaacCAGCATTGCCCCCTTAGCCAc
#63 CATGTGGCTCAGGGTGGCTAAGG 60% + 72 1608 47|73|1488 3.07 | 2.52 | 2.36 30 ★★☆☆ 49 caccgCATGTGGCTCAGGGTGGCTA aaacTAGCCACCCTGAGCCACATGc
#64 GTGCTGGACTGTTTGTGCAGGGC 55% + 37 1367 20|20|1327 4.46 | 2.44 | 1.71 30 ★★★☆ 60 caccGTGCTGGACTGTTTGTGCAG aaacCTGCACAAACAGTCCAGCAC
#65 CTTAGCCACCCTGAGCCACATGG 60% - -35 934 28|49|857 4.12 | 2.66 | 2.52 26 ★★☆☆ 48 caccgCTTAGCCACCCTGAGCCACA aaacTGTGGCTCAGGGTGGCTAAGc
#66 CAGGGTGGCTAAGGGGGCAATGC 65% + 81 1150 25|45|1080 100 | 5.89 | 4.32 25 ★★☆☆ 60 caccgCAGGGTGGCTAAGGGGGCAA aaacTTGCCCCCTTAGCCACCCTGc
#67 AGGGGACCCATGTGGCTCAGGGT 65% + 64 784 25|39|720 68.3 | 7.41 | 7.41 24 ★★★☆ 47.5 caccgAGGGGACCCATGTGGCTCAG aaacCTGAGCCACATGGGTCCCCTc
#68 GGGACCCATGTGGCTCAGGGTGG 70% + 66 1121 38|47|1036 100 | 6.38 | 3.7 22 ★★☆☆ 56 caccGGGACCCATGTGGCTCAGGG aaacCCCTGAGCCACATGGGTCCC
#69 TTAGCCACCCTGAGCCACATGGG 55% - -36 1016 37|25|954 2.6 | 2.6 | 2.6 22 ★★★☆ 40 caccgTTAGCCACCCTGAGCCACAT aaacATGTGGCTCAGGGTGGCTAAc
#70 GGACCCATGTGGCTCAGGGTGGC 65% + 67 1095 29|32|1034 100 | 100 | 6.01 16 ★★★☆ 46 caccGGACCCATGTGGCTCAGGGT aaacACCCTGAGCCACATGGGTCC
#71 TAGCCACCCTGAGCCACATGGGT 60% - -37 1735 55|28|1652 5.72 | 4.79 | 4.58 14 ★★★☆ 42 caccgTAGCCACCCTGAGCCACATG aaacCATGTGGCTCAGGGTGGCTAc
Table 2: Guide sgRNAs for the sequence [example2]
Guide # sgRNA Sequence(+PAM) GC content Strand Position on
sequence
Off-target
Number
Off-target Number
at TSS|Exon|Intergenic
Top3 Off-target
Sites Scores
sgRNA Score
(Based on Off-target)
PAM Score Cas9 Loading
Score
Forward oligo primer Reverse oligo primer
#1 CCGGCCGCCACTCAAGTGGGGAA 75% + 9 17 0|3|14 0.35 | 0.35 | 0.24 97 ★★☆☆ 48.5 caccgCCGGCCGCCACTCAAGTGGG aaacCCCACTTGAGTGGCGGCCGGc
#2 AGTGGGGAAGCTTCCGCGACTGC 65% + 23 142 6|16|120 1.07 | 0.71 | 0.56 89 ★★☆☆ 47 caccgAGTGGGGAAGCTTCCGCGAC aaacGTCGCGGAAGCTTCCCCACTc
#3 GGCCGCTGAGCAGTCGCGGAAGC 75% - -2 156 15|33|108 0.82 | 0.55 | 0.54 87 ★★☆☆ 57 caccGGCCGCTGAGCAGTCGCGGA aaacTCCGCGACTGCTCAGCGGCC
#4 CACTTGAGTGGCGGCCGGCCCGC 75% - -30 124 14|18|92 3.59 | 1.06 | 0.91 82 ★★☆☆ 46 caccgCACTTGAGTGGCGGCCGGCC aaacGGCCGGCCGCCACTCAAGTGc
#5 GGCGGGCCGGCCGCCACTCAAGT 85% + 3 104 11|37|56 1.63 | 1.33 | 1.29 81 ★★☆☆ 43 caccGGCGGGCCGGCCGCCACTCA aaacTGAGTGGCGGCCGGCCCGCC
#6 CGGGCCGGCCGCCACTCAAGTGG 80% + 5 83 13|22|48 1.46 | 1.29 | 1.03 80 ★★☆☆ 53 caccgCGGGCCGGCCGCCACTCAAG aaacCTTGAGTGGCGGCCGGCCCGc
#7 GCCGGCCGCCACTCAAGTGGGGA 75% + 8 97 3|13|81 0.98 | 0.96 | 0.94 80 ★☆☆☆ 54 caccGCCGGCCGCCACTCAAGTGG aaacCCACTTGAGTGGCGGCCGGC
#8 GTCGCGGAAGCTTCCCCACTTGA 65% - -14 91 6|9|76 1.51 | 1.38 | 1.31 79 ★★★☆ 33 caccGTCGCGGAAGCTTCCCCACT aaacAGTGGGGAAGCTTCCGCGAC
#9 GGCCGGCCGCCACTCAAGTGGGG 75% + 7 84 6|12|66 2.46 | 2.34 | 1.62 77 ★★★☆ 43 caccGGCCGGCCGCCACTCAAGTG aaacCACTTGAGTGGCGGCCGGCC
#10 TTCCCCACTTGAGTGGCGGCCGG 65% - -25 220 8|13|199 2.33 | 0.99 | 0.9 75 ★★★☆ 49 caccgTTCCCCACTTGAGTGGCGGC aaacGCCGCCACTCAAGTGGGGAAc
#11 TCCCCACTTGAGTGGCGGCCGGC 70% - -26 190 6|19|165 2.52 | 1.31 | 1.29 74 ★★★☆ 46 caccgTCCCCACTTGAGTGGCGGCC aaacGGCCGCCACTCAAGTGGGGAc
#12 GGAAGCTTCCGCGACTGCTCAGC 65% + 28 204 9|27|168 1.27 | 1.22 | 1.06 71 ★★☆☆ 41 caccGGAAGCTTCCGCGACTGCTC aaacGAGCAGTCGCGGAAGCTTCC
#13 CGCGGAAGCTTCCCCACTTGAGT 65% - -16 135 7|10|118 1.71 | 1.63 | 1.38 67 ★★☆☆ 37 caccgCGCGGAAGCTTCCCCACTTG aaacCAAGTGGGGAAGCTTCCGCGc
#14 CGGAAGCTTCCCCACTTGAGTGG 60% - -18 220 7|8|205 1.52 | 1.29 | 1.11 66 ★★☆☆ 46.5 caccgCGGAAGCTTCCCCACTTGAG aaacCTCAAGTGGGGAAGCTTCCGc
#15 CTCAAGTGGGGAAGCTTCCGCGA 60% + 19 295 18|16|261 1.11 | 1.1 | 0.85 66 ★★★★ 42.5 caccgCTCAAGTGGGGAAGCTTCCG aaacCGGAAGCTTCCCCACTTGAGc
#16 GGGCCGGCCGCCACTCAAGTGGG 75% + 6 155 4|19|132 1.56 | 1.41 | 1.29 65 ★★★☆ 39 caccGGGCCGGCCGCCACTCAAGT aaacACTTGAGTGGCGGCCGGCCC
#17 GGCCGCCACTCAAGTGGGGAAGC 70% + 11 209 9|16|184 1.73 | 1.63 | 1.46 63 ★★☆☆ 61 caccGGCCGCCACTCAAGTGGGGA aaacTCCCCACTTGAGTGGCGGCC
#18 GGAAGCTTCCCCACTTGAGTGGC 55% - -19 320 11|15|294 1.5 | 1.38 | 1.32 60 ★★★☆ 44 caccGGAAGCTTCCCCACTTGAGT aaacACTCAAGTGGGGAAGCTTCC
#19 AAGCTTCCCCACTTGAGTGGCGG 55% - -21 369 14|25|330 4.6 | 1.63 | 1.54 55 ★★★☆ 54 caccgAAGCTTCCCCACTTGAGTGG aaacCCACTCAAGTGGGGAAGCTTc
#20 AAGCTTCCGCGACTGCTCAGCGG 60% + 30 239 11|24|204 3.9 | 2.47 | 1.56 55 ★★★☆ 47.5 caccgAAGCTTCCGCGACTGCTCAG aaacCTGAGCAGTCGCGGAAGCTTc
#21 AGCTTCCGCGACTGCTCAGCGGC 65% + 31 280 12|27|241 6.16 | 4.6 | 3.67 49 ★★★☆ 47 caccgAGCTTCCGCGACTGCTCAGC aaacGCTGAGCAGTCGCGGAAGCTc
#22 AGCTTCCCCACTTGAGTGGCGGC 60% - -22 459 18|27|414 2.52 | 1.78 | 1.73 47 ★★★☆ 40.5 caccgAGCTTCCCCACTTGAGTGGC aaacGCCACTCAAGTGGGGAAGCTc
#23 CACTCAAGTGGGGAAGCTTCCGC 55% + 17 562 9|20|533 3.56 | 2.39 | 2.34 41 ★★☆☆ 29 caccgCACTCAAGTGGGGAAGCTTC aaacGAAGCTTCCCCACTTGAGTGc
Table 3: Guide sgRNAs for the sequence [example3]
Guide # sgRNA Sequence(+PAM) GC content Strand Position on
sequence
Off-target
Number
Off-target Number
at TSS|Exon|Intergenic
Top3 Off-target
Sites Scores
sgRNA Score
(Based on Off-target)
PAM Score Cas9 Loading
Score
Forward oligo primer Reverse oligo primer
#1 CCGACGCTGTTCATGGCGGTGAT 65% - -16 15 0|2|13 1.48 | 0.76 | 0.32 96 ★★☆☆ 42 caccgCCGACGCTGTTCATGGCGGT aaacACCGCCATGAACAGCGTCGGc
#2 GCAGCTGCCATCACCGCCATGAA 65% + 7 66 0|9|57 1.42 | 0.84 | 0.8 89 ★★☆☆ 41 caccGCAGCTGCCATCACCGCCAT aaacATGGCGGTGATGGCAGCTGC
#3 ACCGCCATGAACAGCGTCGGGGA 65% + 19 90 1|18|71 1.11 | 0.81 | 0.74 88 ★☆☆☆ 49.5 caccgACCGCCATGAACAGCGTCGG aaacCCGACGCTGTTCATGGCGGTc
#4 CACCGCCATGAACAGCGTCGGGG 65% + 18 109 2|29|78 0.53 | 0.53 | 0.51 88 ★★★☆ 47 caccgCACCGCCATGAACAGCGTCG aaacCGACGCTGTTCATGGCGGTGc
#5 CGCCATGAACAGCGTCGGGGAGG 70% + 21 102 3|31|68 0.91 | 0.73 | 0.56 87 ★★☆☆ 61 caccgCGCCATGAACAGCGTCGGGG aaacCCCCGACGCTGTTCATGGCGc
#6 AGTGCAAGCCTCCCCGACGCTGT 70% - -3 129 5|20|104 3.59 | 0.71 | 0.43 86 ★★★☆ 49 caccgAGTGCAAGCCTCCCCGACGC aaacGCGTCGGGGAGGCTTGCACTc
#7 CCCGACGCTGTTCATGGCGGTGA 70% - -15 99 2|21|76 1.71 | 1.48 | 1.46 84 ★★★☆ 62 caccgCCCGACGCTGTTCATGGCGG aaacCCGCCATGAACAGCGTCGGGc
#8 ATCACCGCCATGAACAGCGTCGG 55% + 16 185 6|12|167 0.92 | 0.81 | 0.54 80 ★★★☆ 47 caccgATCACCGCCATGAACAGCGT aaacACGCTGTTCATGGCGGTGATc
#9 GCCATGAACAGCGTCGGGGAGGC 65% + 22 260 10|38|212 0.86 | 0.83 | 0.82 76 ★★★☆ 61 caccGCCATGAACAGCGTCGGGGA aaacTCCCCGACGCTGTTCATGGC
#10 TCACCGCCATGAACAGCGTCGGG 60% + 17 201 2|26|173 1.27 | 1.02 | 0.89 75 ★★★☆ 36 caccgTCACCGCCATGAACAGCGTC aaacGACGCTGTTCATGGCGGTGAc
#11 AGCCTCCCCGACGCTGTTCATGG 65% - -9 176 5|32|139 2.11 | 1.31 | 0.85 72 ★★☆☆ 34.5 caccgAGCCTCCCCGACGCTGTTCA aaacTGAACAGCGTCGGGGAGGCTc
#12 GCCTCCCCGACGCTGTTCATGGC 65% - -10 160 3|18|139 4.6 | 1.46 | 1.09 71 ★★★☆ 32.5 caccGCCTCCCCGACGCTGTTCAT aaacATGAACAGCGTCGGGGAGGC
#13 AGCGTCGGGGAGGCTTGCACTGA 70% + 31 174 6|27|141 1.43 | 0.91 | 0.9 71 ★★★☆ 52 caccgAGCGTCGGGGAGGCTTGCAC aaacGTGCAAGCCTCCCCGACGCTc
#14 TCCCCGACGCTGTTCATGGCGGT 65% - -13 211 6|28|177 1.56 | 1.38 | 1.35 67 ★★★☆ 40.5 caccgTCCCCGACGCTGTTCATGGC aaacGCCATGAACAGCGTCGGGGAc
#15 ACGCTGTTCATGGCGGTGATGGC 55% - -19 192 5|19|168 4.04 | 2.37 | 2.37 67 ★★★☆ 31.5 caccgACGCTGTTCATGGCGGTGAT aaacATCACCGCCATGAACAGCGTc
#16 CTCCCCGACGCTGTTCATGGCGG 65% - -12 206 6|30|170 2.17 | 1.42 | 0.92 66 ★★★☆ 49 caccgCTCCCCGACGCTGTTCATGG aaacCCATGAACAGCGTCGGGGAGc
#17 TGAACAGCGTCGGGGAGGCTTGC 65% + 26 209 6|19|184 1.42 | 1.32 | 1.31 62 ★★☆☆ 39 caccgTGAACAGCGTCGGGGAGGCT aaacAGCCTCCCCGACGCTGTTCAc
#18 CTGCCATCACCGCCATGAACAGC 60% + 11 392 6|29|357 2.66 | 1.42 | 1.4 58 ★★☆☆ 49 caccgCTGCCATCACCGCCATGAAC aaacGTTCATGGCGGTGATGGCAGc
#19 CGCAGCTGCCATCACCGCCATGA 70% + 6 425 19|84|322 1.5 | 1.38 | 1.29 52 ★★★☆ 55 caccgCGCAGCTGCCATCACCGCCA aaacTGGCGGTGATGGCAGCTGCGc
#20 GCCATCACCGCCATGAACAGCGT 60% + 13 383 8|39|336 5.89 | 1.56 | 1.53 51 ★★★★ 55 caccGCCATCACCGCCATGAACAG aaacCTGTTCATGGCGGTGATGGC
#21 GACGCTGTTCATGGCGGTGATGG 60% - -18 280 4|42|234 6.01 | 4.04 | 2.42 50 ★★☆☆ 54 caccGACGCTGTTCATGGCGGTGA aaacTCACCGCCATGAACAGCGTC
#22 CTGTTCATGGCGGTGATGGCAGC 60% - -22 483 10|45|428 6.38 | 1.56 | 1.56 49 ★★☆☆ 40.5 caccgCTGTTCATGGCGGTGATGGC aaacGCCATCACCGCCATGAACAGc
#23 TTCATGGCGGTGATGGCAGCTGC 60% - -25 501 11|53|437 4.21 | 3.17 | 2.56 39 ★★☆☆ 47 caccgTTCATGGCGGTGATGGCAGC aaacGCTGCCATCACCGCCATGAAc
#24 GTCACCGCAGCTGCCATCACCGC 65% + 1 556 12|81|463 100 | 4.32 | 1.69 29 ★★☆☆ 39.5 caccGTCACCGCAGCTGCCATCAC aaacGTGATGGCAGCTGCGGTGAC
#25 CATGGCGGTGATGGCAGCTGCGG 65% - -27 762 14|99|649 100 | 4.04 | 3.41 27 ★★★☆ 49 caccgCATGGCGGTGATGGCAGCTG aaacCAGCTGCCATCACCGCCATGc
#26 ATGGCGGTGATGGCAGCTGCGGT 65% - -28 854 19|126|709 3.71 | 2.52 | 2.52 26 ★★★☆ 42 caccgATGGCGGTGATGGCAGCTGC aaacGCAGCTGCCATCACCGCCATc
#27 GGCGGTGATGGCAGCTGCGGTGA 75% - -30 1229 118|388|723 100 | 6.24 | 6.24 24 ★★★☆ 62 caccGGCGGTGATGGCAGCTGCGG aaacCCGCAGCTGCCATCACCGCC
 
Sequence: example1(127 bp)

GTCGCTCGTCGGAGCTGCAGGGACCGGCGCGAGCGAGTGCTGGACTGTTTGTGCAGGGCTCCGAGGGGACCCATGTGGCTCAGGGTGGCTAAGGGGGCAATGCTGCGTCGTCGTAGTTTTTTGGGGG

Potential guide sgRNA number: 71
        These two kinds of sgRNA will be removed automatically: 1) GC content >80% or <20%; 2) >=50% nucleotides are As, Gs, Gs or Ts.

# Score Sequence
#1 95 GGGCAATGCTGCGTCGTCGTAGT
#2 94 CCAAAAAACTACGACGACGCAGC
#3 92 GCTGCGTCGTCGTAGTTTTTTGG
#4 90 AGGGGGCAATGCTGCGTCGTCGT
#5 89 AAACTACGACGACGCAGCATTGC
#6 89 CCCCCAAAAAACTACGACGACGC
#7 87 AGTCCAGCACTCGCTCGCGCCGG
#8 84 GTCCCTGCAGCTCCGACGAGCGA
#9 84 AACAGTCCAGCACTCGCTCGCGC
#10 83 GACCGGCGCGAGCGAGTGCTGGA
#11 83 GTCCAGCACTCGCTCGCGCCGGT
#12 82 CGGTCCCTGCAGCTCCGACGAGC
#13 81 GCGTCGTCGTAGTTTTTTGGGGG
#14 80 GGACCGGCGCGAGCGAGTGCTGG
#15 80 TCGCTCGCGCCGGTCCCTGCAGC
#16 78 TGCGTCGTCGTAGTTTTTTGGGG
#17 78 CTGCGTCGTCGTAGTTTTTTGGG
#18 77 CTAAGGGGGCAATGCTGCGTCGT
#19 76 AGCCACATGGGTCCCCTCGGAGC
#20 75 GGCGCGAGCGAGTGCTGGACTGT
#21 75 CGACGCAGCATTGCCCCCTTAGC
#22 72 TGCAGGGACCGGCGCGAGCGAGT
#23 72 GTCGCTCGTCGGAGCTGCAGGGA
#24 71 GAGCTGCAGGGACCGGCGCGAGC
#25 69 GCTGCAGGGACCGGCGCGAGCGA
#26 68 CGAGCGAGTGCTGGACTGTTTGT
#27 66 CAAACAGTCCAGCACTCGCTCGC
#28 66 GGCTCCGAGGGGACCCATGTGGC
#29 64 CGGAGCTGCAGGGACCGGCGCGA
#30 62 CAGGGACCGGCGCGAGCGAGTGC
#31 62 CTGTTTGTGCAGGGCTCCGAGGG
#32 56 ACTGTTTGTGCAGGGCTCCGAGG
#33 56 AGCGAGTGCTGGACTGTTTGTGC
#34 55 GTCGGAGCTGCAGGGACCGGCGC
#35 55 GGGCTCCGAGGGGACCCATGTGG
#36 55 GTTTGTGCAGGGCTCCGAGGGGA
#37 54 TGTTTGTGCAGGGCTCCGAGGGG
#38 53 CGCGCCGGTCCCTGCAGCTCCGA
#39 53 TCGTCGGAGCTGCAGGGACCGGC
#40 52 CACTCGCTCGCGCCGGTCCCTGC
#41 52 GCCGGTCCCTGCAGCTCCGACGA
#42 50 TGAGCCACATGGGTCCCCTCGGA
#43 50 CGAGGGGACCCATGTGGCTCAGG
#44 49 CCTCGGAGCCCTGCACAAACAGT
#45 47 CTCGTCGGAGCTGCAGGGACCGG
#46 47 CTGAGCCACATGGGTCCCCTCGG
#47 46 GAGCCCTGCACAAACAGTCCAGC
#48 46 TGCACAAACAGTCCAGCACTCGC
#49 46 CATGGGTCCCCTCGGAGCCCTGC
#50 44 ATGTGGCTCAGGGTGGCTAAGGG
#51 43 CATTGCCCCCTTAGCCACCCTGA
#52 43 GGTGGCTAAGGGGGCAATGCTGC
#53 39 GAGGGGACCCATGTGGCTCAGGG
#54 39 GTGGCTCAGGGTGGCTAAGGGGG
#55 39 TGGCTCAGGGTGGCTAAGGGGGC
#56 38 TTGCCCCCTTAGCCACCCTGAGC
#57 37 GAGTGCTGGACTGTTTGTGCAGG
#58 36 TGTGGCTCAGGGTGGCTAAGGGG
#59 36 CAGGGCTCCGAGGGGACCCATGT
#60 35 GGACTGTTTGTGCAGGGCTCCGA
#61 33 AGTGCTGGACTGTTTGTGCAGGG
#62 30 TGGCTAAGGGGGCAATGCTGCGT
#63 30 CATGTGGCTCAGGGTGGCTAAGG
#64 30 GTGCTGGACTGTTTGTGCAGGGC
#65 26 CTTAGCCACCCTGAGCCACATGG
#66 25 CAGGGTGGCTAAGGGGGCAATGC
#67 24 AGGGGACCCATGTGGCTCAGGGT
#68 22 GGGACCCATGTGGCTCAGGGTGG
#69 22 TTAGCCACCCTGAGCCACATGGG
#70 16 GGACCCATGTGGCTCAGGGTGGC
#71 14 TAGCCACCCTGAGCCACATGGGT


Legend
High quality
Low quality
Guide sgRNA # 1
sgRNA score: 95
GC content: 65%
Strand: Forward
Potential off-target sites: 66 (Mismatch site number <=4)
Oligos to order: FWD: caccGGGCAATGCTGCGTCGTCGT REV: aaacACGACGACGCAGCATTGCCC

Top 20 off-target sites were shown here.
# Sequence Score Mismatch Genomic locus Genomic annotation
#1 GGGCggcGCcGCGTCGTCGT CGT 0.51 4MMs [5:6:7:10] chr18|38418891|+ Ndfip1|TSS upstream +2kb,Ndfip1|exon
#2 GGGacATGtTtCGTCGTCGT CGT 0.47 4MMs [4:5:9:11] chr8|119874183|-
#3 aGGCAAaGCaGgGTCGTCGT GGT 0.45 4MMs [1:7:10:12] chr17|86347110|-
#4 caGCAcTGCTGCcTCGTCGT TGA 0.35 4MMs [1:2:6:13] chr17|50086767|-
#5 GaaCAATGCTGaGTCGaCGT GGC 0.29 4MMs [2:3:12:17] chr7|55988953|+
#6 GGcCAAgGaTGCcTCGTCGT AGA 0.23 4MMs [3:7:9:13] chr13|40800542|+
#7 aGGaAAgGCTGCGTCGTgGT GGT 0.21 4MMs [1:4:7:18] chr13|107793431|-
#8 GGcCAcTGaTGCGTCGTCtT CGA 0.18 4MMs [3:6:9:19] chr10|93162133|- Mir1931|TSS upstream +2kb
#9 GGtCAATGgaGCGTCGTgGT GGA 0.17 4MMs [3:9:10:18] chr3|122440975|+
#10 GGatAATGCTGgGTCGTgGT AGG 0.15 4MMs [3:4:12:18] chr3|86889856|-
#11 GGaCAATGgTGgGTCGTCcT GGG 0.15 4MMs [3:9:12:19] chr3|10357387|-
#12 GGGCgAcGgTGCGTCGTaGT CGG 0.12 4MMs [5:7:9:18] chr1|171065434|- Mir6546|TSS upstream +2kb
#13 GGGCgAcGgTGCGTCGTaGT CGG 0.12 4MMs [5:7:9:18] chr1|171080683|-
#14 GGGCgAcGgTGCGTCGTaGT CGG 0.12 4MMs [5:7:9:18] chr1|171073069|-
#15 GGGacATGCTGCGTCagCGT GGG 0.1 4MMs [4:5:16:17] chr17|29389361|+
#16 GGGCAgaGCTGgGTCGTCcT AGC 0.09 4MMs [6:7:12:19] chr11|107881324|-
#17 GGGCAAgGgcGCGTCcTCGT GGG 0.09 4MMs [7:9:10:16] chr17|34197773|+ Psmb8|TSS upstream +2kb
#18 aGGCAATGCTtgGTCtTCGT TGC 0.07 4MMs [1:11:12:16] chr7|52027194|-
#19 GGGCtcTGCTGCGTCtTCGa TGG 0.06 4MMs [5:6:16:20] chr12|32849634|-
#20 GGGCAATcCTcCGTaGTCaT AGA 0.06 4MMs [8:11:15:19] chrY|9658244|-
Sequence: example2(55 bp)

GAGGCGGGCCGGCCGCCACTCAAGTGGGGAAGCTTCCGCGACTGCTCAGCGGCCG

Potential guide sgRNA number: 23
        These two kinds of sgRNA will be removed automatically: 1) GC content >80% or <20%; 2) >=50% nucleotides are As, Gs, Gs or Ts.

# Score Sequence
#1 97 CCGGCCGCCACTCAAGTGGGGAA
#2 89 AGTGGGGAAGCTTCCGCGACTGC
#3 87 GGCCGCTGAGCAGTCGCGGAAGC
#4 82 CACTTGAGTGGCGGCCGGCCCGC
#5 81 GGCGGGCCGGCCGCCACTCAAGT
#6 80 CGGGCCGGCCGCCACTCAAGTGG
#7 80 GCCGGCCGCCACTCAAGTGGGGA
#8 79 GTCGCGGAAGCTTCCCCACTTGA
#9 77 GGCCGGCCGCCACTCAAGTGGGG
#10 75 TTCCCCACTTGAGTGGCGGCCGG
#11 74 TCCCCACTTGAGTGGCGGCCGGC
#12 71 GGAAGCTTCCGCGACTGCTCAGC
#13 67 CGCGGAAGCTTCCCCACTTGAGT
#14 66 CGGAAGCTTCCCCACTTGAGTGG
#15 66 CTCAAGTGGGGAAGCTTCCGCGA
#16 65 GGGCCGGCCGCCACTCAAGTGGG
#17 63 GGCCGCCACTCAAGTGGGGAAGC
#18 60 GGAAGCTTCCCCACTTGAGTGGC
#19 55 AAGCTTCCCCACTTGAGTGGCGG
#20 55 AAGCTTCCGCGACTGCTCAGCGG
#21 49 AGCTTCCGCGACTGCTCAGCGGC
#22 47 AGCTTCCCCACTTGAGTGGCGGC
#23 41 CACTCAAGTGGGGAAGCTTCCGC


Legend
High quality
Low quality
Guide sgRNA # 1
sgRNA score: 97
GC content: 75%
Strand: Forward
Potential off-target sites: 17 (Mismatch site number <=4)
Oligos to order: FWD: caccgCCGGCCGCCACTCAAGTGGG REV: aaacCCCACTTGAGTGGCGGCCGGc

Top 20 off-target sites were shown here.
# Sequence Score Mismatch Genomic locus Genomic annotation
#1 CtGGtCtCCACTCAAGTGtG GAA 0.35 4MMs [2:5:7:19] chr11|55236692|-
#2 CCcGCCGCCgggCAAGTGGG GAA 0.35 4MMs [3:10:11:12] chr4|21679605|- Prdm13|exon
#3 CaGcCtGCCACTCAtGTGGG GAA 0.24 4MMs [2:4:6:15] chr5|144889654|+
#4 CtGGCCtCCAgTCAAGcGGG GAT 0.23 4MMs [2:7:11:17] chr12|110352230|-
#5 CCtGCtGCCcCTCAtGTGGG GAA 0.22 4MMs [3:6:10:15] chr19|5422722|+ 4930481A15Rik|exon
#6 CCGcCCcCCAtTCAAGaGGG GAA 0.22 4MMs [4:7:11:17] chr11|94698538|+
#7 CCGGCCtgCACaCAAGaGGG GAT 0.18 4MMs [7:8:12:17] chr5|18799114|+
#8 CtGGCCaCCAgTCAtGTGGG GAA 0.15 4MMs [2:7:11:15] chr17|52744784|-
#9 CtGGCCaCCACTCAtGTGGt GAA 0.12 4MMs [2:7:15:20] chr8|88583467|-
#10 CaGGCCcCCACTCAAGgtGG GAA 0.08 4MMs [2:7:17:18] chr10|58231365|- Dux|exon
#11 CaGGCCcCCACTCAAGgtGG GAA 0.08 4MMs [2:7:17:18] chr10|58228571|-
#12 CaGGCCcCCACTCAAGgtGG GAA 0.08 4MMs [2:7:17:18] chr10|58228022|-
#13 CaGGCCcCCACTCAAGgtGG GAA 0.08 4MMs [2:7:17:18] chr10|58223686|-
#14 CaGGCCcCCACTCAAGgtGG GAA 0.08 4MMs [2:7:17:18] chr10|58223137|-
#15 CCaGaCGCCACTCAAcTGaG GAA 0.08 4MMs [3:5:16:19] chr7|14997154|+
#16 CCGcCaGCCACTCAAGTaGt GAT 0.07 4MMs [4:6:18:20] chr10|36855326|-
#17 CCGGCCtCCACTCAtGTctG GAT 0.01 4MMs [7:15:18:19] chr8|95729990|-
Sequence: example3(53 bp)

GTCACCGCAGCTGCCATCACCGCCATGAACAGCGTCGGGGAGGCTTGCACTGA

Potential guide sgRNA number: 27
        These two kinds of sgRNA will be removed automatically: 1) GC content >80% or <20%; 2) >=50% nucleotides are As, Gs, Gs or Ts.

# Score Sequence
#1 96 CCGACGCTGTTCATGGCGGTGAT
#2 89 GCAGCTGCCATCACCGCCATGAA
#3 88 ACCGCCATGAACAGCGTCGGGGA
#4 88 CACCGCCATGAACAGCGTCGGGG
#5 87 CGCCATGAACAGCGTCGGGGAGG
#6 86 AGTGCAAGCCTCCCCGACGCTGT
#7 84 CCCGACGCTGTTCATGGCGGTGA
#8 80 ATCACCGCCATGAACAGCGTCGG
#9 76 GCCATGAACAGCGTCGGGGAGGC
#10 75 TCACCGCCATGAACAGCGTCGGG
#11 72 AGCCTCCCCGACGCTGTTCATGG
#12 71 GCCTCCCCGACGCTGTTCATGGC
#13 71 AGCGTCGGGGAGGCTTGCACTGA
#14 67 TCCCCGACGCTGTTCATGGCGGT
#15 67 ACGCTGTTCATGGCGGTGATGGC
#16 66 CTCCCCGACGCTGTTCATGGCGG
#17 62 TGAACAGCGTCGGGGAGGCTTGC
#18 58 CTGCCATCACCGCCATGAACAGC
#19 52 CGCAGCTGCCATCACCGCCATGA
#20 51 GCCATCACCGCCATGAACAGCGT
#21 50 GACGCTGTTCATGGCGGTGATGG
#22 49 CTGTTCATGGCGGTGATGGCAGC
#23 39 TTCATGGCGGTGATGGCAGCTGC
#24 29 GTCACCGCAGCTGCCATCACCGC
#25 27 CATGGCGGTGATGGCAGCTGCGG
#26 26 ATGGCGGTGATGGCAGCTGCGGT
#27 24 GGCGGTGATGGCAGCTGCGGTGA


Legend
High quality
Low quality
Guide sgRNA # 1
sgRNA score: 96
GC content: 65%
Strand: Reverse
Potential off-target sites: 15 (Mismatch site number <=4)
Oligos to order: FWD: caccgCCGACGCTGTTCATGGCGGT REV: aaacACCGCCATGAACAGCGTCGGc

Top 20 off-target sites were shown here.
# Sequence Score Mismatch Genomic locus Genomic annotation
#1 CtGACaCTGaTCATGGCGGT GAT 1.48 3MMs [2:6:10] chr9|120895933|-
#2 CCaAaGCTagTCATGGCGGT GAA 0.76 4MMs [3:5:9:10] chr11|96856457|+
#3 CCtACcCTGaTCATGGaGGT GAA 0.32 4MMs [3:6:10:17] chr5|73688707|+
#4 CCcAtGCTGTgCATGGtGGT GAT 0.32 4MMs [3:5:11:17] chr7|64895781|-
#5 CCGAaGCTGgTCATGGaGcT GAT 0.17 4MMs [5:10:17:19] chr11|61678556|- Slc5a10|exon
#6 CaGACaCTGTTgATGGCGaT GAT 0.15 4MMs [2:6:12:19] chr8|23985881|-
#7 CCtcCaCTGTTCATGtCGGT GAT 0.15 4MMs [3:4:6:16] chr15|4753125|+
#8 CCGACctTcTTCATGGtGGT GAA 0.14 4MMs [6:7:9:17] chr7|70491153|-
#9 CtGAaGCTGTTCcTGGCaGT GAT 0.12 4MMs [2:5:13:18] chr8|46920746|-
#10 CCcAgGCTGTTCATGGgtGT GAA 0.11 4MMs [3:5:17:18] chr17|14287838|+
#11 CaGAaGCTGTTCAaGGtGGT GAA 0.09 4MMs [2:5:14:17] chr9|83679650|+
#12 CaGACGCTGTaaAaGGCGGT GAT 0.06 4MMs [2:11:12:14] chr4|148327336|-
#13 gCGAtGCTGTTCAcGGCaGT GAT 0.04 4MMs [1:5:14:18] chr7|134723194|+
#14 CCaACtCTGTTCAaGGCaGT GAT 0.02 4MMs [3:6:14:18] chr3|96931594|-
#15 CCGACGCTGTcCAgGGtGcT GAA 0.01 4MMs [11:14:17:19] chr17|72603314|- Alk|exon




© 2018 This website is maintained by Casellas Lab at NIH/NIAMS
Developed & Designed by Yongbing Zhao